The objective of this assignment to give you more practice in writing classes.

Background: The genetic code is stored in the nucleus of each cell using a molecule called DNA. A DNA molecule is a linear chain of one of the four nucleotides, 'A', 'C', 'G', and 'T'. As computer scientists we think of it as a string over a four letter alphabet. For example, the first few nucleotides in chromosome 22 of the human genome are ATACATATATATG. As you may know, the human genome has been sequenced, so we know (more or less) the full sequence, which contains over 3 billion nucleotides. A first step towards analyzing such data is writing a Java class that can store and manipulate such sequences. We will call this class DNAsequence.
An object of the class DNA sequence is characterized by two pieces of data: a string ID, which is an identifier assigned to the sequence, and the actual sequence. Your class should store these in two variables that are declared as private. Your DNAsequence class is supposed to have the following methods:

• public DNAsequence(String sequence, String id)
  A constructor that creates a new instance given a Java string that contains the sequence. The allowed letters for a DNA sequence object are 'A', 'C', 'G', 'T', and 'N', where 'N' represents the case where the nucleotide in a given position could not be determined. If the user tries to create a sequence that is not a valid DNA sequence, the constructor should raise an exception. The sequence should be stored as upper-case letters, even if it is provided in lower case.
  
  
  
• public DNAsequence(String filename)
  This constructor creates a new instance from a file. DNA and protein sequence are usually stored in a file format called fasta, which is specified here. Assume that the file contains a single DNA sequence, and So for example, the coding sequence for a human gene called calmodulin whose identifier is M19311.1 will be provided as:
  

  >M19311.1
  GCGAGCTGAGTGGTTGTGTGGTCGCGTCTCGGAAACCGGTAGCGCTTGCAGCATGGCTGACCAACTGACT
  GAAGAGCAGATTGCAGAATTCAAAGAAGCTTTTTCATTATTTGACAAAGATGGTGATGGCACTATAACAA
  CAAAGGAACTTGGGACTGTAATGAGATCTCTTGGGCAGAATCCCACAGAAGCAGAGTTACAGGACATGAT
  TAATGAAGTAGATGCTGATGGTAATGGCACAATTGACTTTCCTGAATTTCTGACAATGATGGCAAGAAAA
  ATGAAAGACACAGACAGTGAAGAAGAAATTAGAGAAGCATTCCGTGTGTTTGACAAGGATGGCAATGGCT
  ATATTAGTGCTGCAGAACTTCGCCATGTGATGACAAACCTTGGAGAGAAGTTAACAGATGAAGAAGTTGA
  TGAAATGATCAGGGAAGCAGATATTGATGGTGATGGTCAAGTAAACTATGAAGAGTTTGTACAAATGATG
  ACAGCAAAGTGAAGACCTTGTACAGAATGTGTTAAATTTCTTGTACAAAATTGTTTATTTGCCTTTTCTT
  TGTTTGTAACTTATCTGTAAAAGGTTTCTCCCTACTGTCAAAAAAAAATATGCATGTATAGTAATTTAGG
  ACTTCATTCCTCCATGTTTTCTTCCCTTATCTTACTGTCATTGTCCTAAAACCTATTTAGAAAATTGATC
  AGTAACATGTTGCATGTGGCTTACTCTGGCTATATCTAAGCCCTTCGTCACATCTAAACTTAGATGGAGT
  TGGTCAAATGAGGGAACATCTGGGTTATGCCTTTTTTTAAGTAGTTTTCTTTAGGAACTGTCAGCATGAT
  GTTGTTGAAGTGTGGAGTTGTAACTCTGCGTGGACTATGGACAGTCGACTATGGACACTCAACAATATGT
  ACTTAAAAAGTGCACTATGCAAACGGGTGTATTATCCAGGTGATCGTACACTATTTTTTTGTACTGCTGG
  TCCTGTACCAGAAACATTTTCTTTTATTGTTACTTGCTTTTTAAACTTTGTTTAGCCACTTACTTAAAAG
  ATCTGCTTATGGCACAATTTGCCTCAAATCCATTCCAAGTTGTATATTTGTTTTCCAATAAAAAAAATTA
  CAATTT
  

  
  And here's the actual file. Note that the sequence can span multiple lines in the file, and it should be stored in upper-case even if the file has it in lower-case letters. Like the other constructor, it should throw an exception if an illegal character is provided in the sequence. You can assume the file is correctly formatted.
  
  
  
• public String reverseComplement()
  DNA is composed of two complementary strands, wherever there is an 'A' on one strand, there's a 'T' in the other, and 'C' and 'G' are also complementary. However, the two strands are read in different directions. So for example, the reverse complement of:
  

  TATCCTGGCG
  

  is:

  CGCCAGGATA
  

  Also, the complement of an ambiguous nucleotide ('N') is itself. Note that this method does not return a new DNAsequence object since it's not obvious what the id for the reverse-complement should be.
  
  
• public double gcContent()
  The fraction of nucleotides which are either 'G' or 'C' is called the GC content of a sequence. (As a side note, a complementary G-C pair binds with three hydrogen bonds, whereas an A-T pair binds with two hydrogen bonds). GC content is an important characteristic, and each species has a characteristic GC content; furthermore, areas of the genome that code for genes have different GC content than non-coding regions. For example, the GC content of:

  TATCCTGGCG
  

  is 0.6. In computing GC content ignore ambiguous nucleotides ('N'), and compute it out of the total number of non-ambiguous nucleotides. There is a nice discussion of this topic on wikipedia.
  
  
• public boolean equals(Object other)
  Should return true if other is a DNAsequence object with the same sequence. Ignore the ID for this comparison. This will allow you to detect if the same sequence appears multiple times in a database (which is often the case).
  
  
• public String toString()
  This method should return a string representation of the ID and the sequence. If the sequence is longer than 100 nucleotides, have it represent only the first 100 nucleotides.
  
  
• main
  Your main should exercise your DNAsequence class. There are many online tools that will compute the reverse complement of a sequence, so you can easily compare your answer.
  

Submitting Your Assignment

Submit your DNAsequence.java using the checkin program as PA4.
Note that your code should compile on department Linux machines, and make sure that you are submitting the source code rather than the Java class file.